Review



1420 colo320dm atcc cat  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    ATCC 1420 colo320dm atcc cat
    1420 Colo320dm Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 416 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/1420+colo320dm+atcc+cat/COLO+320DM/pm41579861-281-54-56
    Average 95 stars, based on 416 article reviews
    1420 colo320dm atcc cat - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    Multiple Displacement Amplification:

    Article Title: Systematic annotation of orphan RNAs reveals blood-accessible molecular barcodes of cancer identity and cancer-emergent oncogenic drivers.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Anti-Vimentin antibody [EPR3776] - Cytoskeleton Marker Abcam Cat#ab92547; RRID: AB_10562134 Rabbit Anti-E Cadherin antibody [EP700Y] - Intercellular Junction Marker Abcam Cat#ab40772; RRID: AB_731493 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 ThermoFisher Scientific Cat#A-11034; RRID: AB_2576217 Human IgG (Fc) Polyclonal - Isotype Control Abcam Cat#ab206214 Bacterial and virus strains MegaX DH10B T1R electrocompetent cells Invitrogen Cat. #C640003 Biological samples Serum samples from human patients ISPY-2 Clinical Trial N/A Chemicals, peptides, and recombinant proteins FD Esp3I Thermo Fisher Cat. #FD0454 AgeI-HF NEB Cat. #R3552S EcoRI-HF NEB Cat. #R3101S Penicillin-Streptomycin-Glutamine (100×) Thermo Fisher Cat#10378016 Amphotericin B Thermo Fisher Cat#30-003-CF Corning Matrigel Basement Membrane Matrix, LDEV-free Corning Cat#354234 D-luciferin Revvity Cat#122799 Critical commercial assays DNA Clean and Concentrator kit-5 Zymo Research Cat. #D4003 MinElute PCR purification kit Qiagen Cat. #28004 Select-a-Size DNA Clean & Concentrator MagBead Kit Zymo Cat. #D4084 MiSeq v2 Illumina Cat. #MS-102-2002 Quick-DNA midiprep plus kit Zymo Research Cat. #D4075 QuantSeq 3′ mRNA-Seq Library Prep Kit FWD Lexogen Cat. #015 SMARTer® smRNA-Seq Kit for Illumina Takara Bio Cat#635031 Quick-cfRNA Serum & Plasma Kit Zymo Research Cat#R1059 Deposited data mRNA-seq In this paper Accession: E-MTAB-16091 Experimental models: Cell lines MDA-MB-231 ATCC Cat#HTB-26 SW480 ATCC Cat#CCL-228 A549 ATCC Cat#CCL-185 C4-2B ATCC Cat#CRL-3315 MDA-MB-231 shctrl This paper N/A HCC1806 shctrl This paper N/A MDA-MB-231 oncRNA.ch7.29 This paper N/A HC1806 oncRNA.ch7.29 This paper N/A MDA-MB-231 oncRNA.ch17.67 This paper N/A HCC1806 oncRNA.ch17.67 This paper N/A MCF7 ATCC Cat#HTB-22 (Continued on next page) Cell Reports Medicine 7, 102577, February 17, 2026 e1 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER A375 ATCC Cat#CRL-1619 LS174T ATCC Cat#CL-188 PANC-1 ATCC Cat#CRL-1469 MDA-MB-453 ATCC Cat#HTB-131 Hs 707(A).T ATCC Cat#CRL-7448 HEK293 ATCC Cat#CRL-1573 A2058 ATCC Cat#CRL-3601 HCC-44 DSMZ Cat#ACC534 NCI-H23 ATCC Cat#CRL-5800 NCI-H1299 ATCC Cat#CRL-5803 NCI-H358 ATCC Cat#CRL-5807 BxPC-3 ATCC Cat#CRL-1687 LNCaP ATCC Cat#CRL-1740 ZR-75-1 ATCC Cat#CRL-1500 K-562 ATCC Cat#CCL-243 MIA PaCa-2 ATCC CatCRL-1420 COLO320DM ATCC Cat#CCL-220 HCT116 ATCC Cat#CCL-247 SW620 ATCC Cat#CCL-227 PC-3 ATCC Cat#CRL-1435 Experimental models: Organisms/strains NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ Jackson Laboratory Strain#005557 Oligonucleotides oncTuD library amplification F:ATTTTGCCCCTGGTTCTT IDT N/A oncTuD library amplification R:CCCTAAGAAATGAACTGG IDT N/A oncTuD amplicon-F: GGAAAGGACGAAACACCGGT IDT N/A oncTuD amplicon-R: ATACTGCCATTTGTCTCGAGGTC IDT N/A oncTuD amplicon-F-2: ACACTCTTTCCCTACACGACGCTCTTCCG ATCTGGAAAGGACGAAACACCGGT IDT N/A oncTuD amplicon-R-2: GTGACTGGAGTTCAGACGTGTGCTCTTCCGA TCTATACTGCCATTTGTCTCGAGGTC IDT N/A Illumina TruSeq UDI index set Illumina N/A oAN491 (custom TSO oligo with UMI used with Takara smRNA kit) IDT N/A oAN426 (custom cDNA amplification primer R, used with Takara smRNA kit) IDT N/A oAN425 (example of custom cDNA amplification primer F, used with Takara smRNA kit IDT N/A Recombinant DNA pUC6 Addgene Cat #49793 pLKO.1 Addgene Cat #10878 pLKO.1 shctrl This paper N/A pLKO.1 oncRNA.ch7.29 This paper N/A pLKO.1 oncRNA.ch17.67 This paper N/A (Continued on next page) e2 Cell Reports Medicine 7, 102577, February 17, 2026 Article ll OPEN ACCESS ..

    Library Amplification:

    Article Title: Systematic annotation of orphan RNAs reveals blood-accessible molecular barcodes of cancer identity and cancer-emergent oncogenic drivers.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Anti-Vimentin antibody [EPR3776] - Cytoskeleton Marker Abcam Cat#ab92547; RRID: AB_10562134 Rabbit Anti-E Cadherin antibody [EP700Y] - Intercellular Junction Marker Abcam Cat#ab40772; RRID: AB_731493 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 ThermoFisher Scientific Cat#A-11034; RRID: AB_2576217 Human IgG (Fc) Polyclonal - Isotype Control Abcam Cat#ab206214 Bacterial and virus strains MegaX DH10B T1R electrocompetent cells Invitrogen Cat. #C640003 Biological samples Serum samples from human patients ISPY-2 Clinical Trial N/A Chemicals, peptides, and recombinant proteins FD Esp3I Thermo Fisher Cat. #FD0454 AgeI-HF NEB Cat. #R3552S EcoRI-HF NEB Cat. #R3101S Penicillin-Streptomycin-Glutamine (100×) Thermo Fisher Cat#10378016 Amphotericin B Thermo Fisher Cat#30-003-CF Corning Matrigel Basement Membrane Matrix, LDEV-free Corning Cat#354234 D-luciferin Revvity Cat#122799 Critical commercial assays DNA Clean and Concentrator kit-5 Zymo Research Cat. #D4003 MinElute PCR purification kit Qiagen Cat. #28004 Select-a-Size DNA Clean & Concentrator MagBead Kit Zymo Cat. #D4084 MiSeq v2 Illumina Cat. #MS-102-2002 Quick-DNA midiprep plus kit Zymo Research Cat. #D4075 QuantSeq 3′ mRNA-Seq Library Prep Kit FWD Lexogen Cat. #015 SMARTer® smRNA-Seq Kit for Illumina Takara Bio Cat#635031 Quick-cfRNA Serum & Plasma Kit Zymo Research Cat#R1059 Deposited data mRNA-seq In this paper Accession: E-MTAB-16091 Experimental models: Cell lines MDA-MB-231 ATCC Cat#HTB-26 SW480 ATCC Cat#CCL-228 A549 ATCC Cat#CCL-185 C4-2B ATCC Cat#CRL-3315 MDA-MB-231 shctrl This paper N/A HCC1806 shctrl This paper N/A MDA-MB-231 oncRNA.ch7.29 This paper N/A HC1806 oncRNA.ch7.29 This paper N/A MDA-MB-231 oncRNA.ch17.67 This paper N/A HCC1806 oncRNA.ch17.67 This paper N/A MCF7 ATCC Cat#HTB-22 (Continued on next page) Cell Reports Medicine 7, 102577, February 17, 2026 e1 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER A375 ATCC Cat#CRL-1619 LS174T ATCC Cat#CL-188 PANC-1 ATCC Cat#CRL-1469 MDA-MB-453 ATCC Cat#HTB-131 Hs 707(A).T ATCC Cat#CRL-7448 HEK293 ATCC Cat#CRL-1573 A2058 ATCC Cat#CRL-3601 HCC-44 DSMZ Cat#ACC534 NCI-H23 ATCC Cat#CRL-5800 NCI-H1299 ATCC Cat#CRL-5803 NCI-H358 ATCC Cat#CRL-5807 BxPC-3 ATCC Cat#CRL-1687 LNCaP ATCC Cat#CRL-1740 ZR-75-1 ATCC Cat#CRL-1500 K-562 ATCC Cat#CCL-243 MIA PaCa-2 ATCC CatCRL-1420 COLO320DM ATCC Cat#CCL-220 HCT116 ATCC Cat#CCL-247 SW620 ATCC Cat#CCL-227 PC-3 ATCC Cat#CRL-1435 Experimental models: Organisms/strains NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ Jackson Laboratory Strain#005557 Oligonucleotides oncTuD library amplification F:ATTTTGCCCCTGGTTCTT IDT N/A oncTuD library amplification R:CCCTAAGAAATGAACTGG IDT N/A oncTuD amplicon-F: GGAAAGGACGAAACACCGGT IDT N/A oncTuD amplicon-R: ATACTGCCATTTGTCTCGAGGTC IDT N/A oncTuD amplicon-F-2: ACACTCTTTCCCTACACGACGCTCTTCCG ATCTGGAAAGGACGAAACACCGGT IDT N/A oncTuD amplicon-R-2: GTGACTGGAGTTCAGACGTGTGCTCTTCCGA TCTATACTGCCATTTGTCTCGAGGTC IDT N/A Illumina TruSeq UDI index set Illumina N/A oAN491 (custom TSO oligo with UMI used with Takara smRNA kit) IDT N/A oAN426 (custom cDNA amplification primer R, used with Takara smRNA kit) IDT N/A oAN425 (example of custom cDNA amplification primer F, used with Takara smRNA kit IDT N/A Recombinant DNA pUC6 Addgene Cat #49793 pLKO.1 Addgene Cat #10878 pLKO.1 shctrl This paper N/A pLKO.1 oncRNA.ch7.29 This paper N/A pLKO.1 oncRNA.ch17.67 This paper N/A (Continued on next page) e2 Cell Reports Medicine 7, 102577, February 17, 2026 Article ll OPEN ACCESS ..

    Amplification:

    Article Title: Systematic annotation of orphan RNAs reveals blood-accessible molecular barcodes of cancer identity and cancer-emergent oncogenic drivers.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Anti-Vimentin antibody [EPR3776] - Cytoskeleton Marker Abcam Cat#ab92547; RRID: AB_10562134 Rabbit Anti-E Cadherin antibody [EP700Y] - Intercellular Junction Marker Abcam Cat#ab40772; RRID: AB_731493 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 ThermoFisher Scientific Cat#A-11034; RRID: AB_2576217 Human IgG (Fc) Polyclonal - Isotype Control Abcam Cat#ab206214 Bacterial and virus strains MegaX DH10B T1R electrocompetent cells Invitrogen Cat. #C640003 Biological samples Serum samples from human patients ISPY-2 Clinical Trial N/A Chemicals, peptides, and recombinant proteins FD Esp3I Thermo Fisher Cat. #FD0454 AgeI-HF NEB Cat. #R3552S EcoRI-HF NEB Cat. #R3101S Penicillin-Streptomycin-Glutamine (100×) Thermo Fisher Cat#10378016 Amphotericin B Thermo Fisher Cat#30-003-CF Corning Matrigel Basement Membrane Matrix, LDEV-free Corning Cat#354234 D-luciferin Revvity Cat#122799 Critical commercial assays DNA Clean and Concentrator kit-5 Zymo Research Cat. #D4003 MinElute PCR purification kit Qiagen Cat. #28004 Select-a-Size DNA Clean & Concentrator MagBead Kit Zymo Cat. #D4084 MiSeq v2 Illumina Cat. #MS-102-2002 Quick-DNA midiprep plus kit Zymo Research Cat. #D4075 QuantSeq 3′ mRNA-Seq Library Prep Kit FWD Lexogen Cat. #015 SMARTer® smRNA-Seq Kit for Illumina Takara Bio Cat#635031 Quick-cfRNA Serum & Plasma Kit Zymo Research Cat#R1059 Deposited data mRNA-seq In this paper Accession: E-MTAB-16091 Experimental models: Cell lines MDA-MB-231 ATCC Cat#HTB-26 SW480 ATCC Cat#CCL-228 A549 ATCC Cat#CCL-185 C4-2B ATCC Cat#CRL-3315 MDA-MB-231 shctrl This paper N/A HCC1806 shctrl This paper N/A MDA-MB-231 oncRNA.ch7.29 This paper N/A HC1806 oncRNA.ch7.29 This paper N/A MDA-MB-231 oncRNA.ch17.67 This paper N/A HCC1806 oncRNA.ch17.67 This paper N/A MCF7 ATCC Cat#HTB-22 (Continued on next page) Cell Reports Medicine 7, 102577, February 17, 2026 e1 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER A375 ATCC Cat#CRL-1619 LS174T ATCC Cat#CL-188 PANC-1 ATCC Cat#CRL-1469 MDA-MB-453 ATCC Cat#HTB-131 Hs 707(A).T ATCC Cat#CRL-7448 HEK293 ATCC Cat#CRL-1573 A2058 ATCC Cat#CRL-3601 HCC-44 DSMZ Cat#ACC534 NCI-H23 ATCC Cat#CRL-5800 NCI-H1299 ATCC Cat#CRL-5803 NCI-H358 ATCC Cat#CRL-5807 BxPC-3 ATCC Cat#CRL-1687 LNCaP ATCC Cat#CRL-1740 ZR-75-1 ATCC Cat#CRL-1500 K-562 ATCC Cat#CCL-243 MIA PaCa-2 ATCC CatCRL-1420 COLO320DM ATCC Cat#CCL-220 HCT116 ATCC Cat#CCL-247 SW620 ATCC Cat#CCL-227 PC-3 ATCC Cat#CRL-1435 Experimental models: Organisms/strains NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ Jackson Laboratory Strain#005557 Oligonucleotides oncTuD library amplification F:ATTTTGCCCCTGGTTCTT IDT N/A oncTuD library amplification R:CCCTAAGAAATGAACTGG IDT N/A oncTuD amplicon-F: GGAAAGGACGAAACACCGGT IDT N/A oncTuD amplicon-R: ATACTGCCATTTGTCTCGAGGTC IDT N/A oncTuD amplicon-F-2: ACACTCTTTCCCTACACGACGCTCTTCCG ATCTGGAAAGGACGAAACACCGGT IDT N/A oncTuD amplicon-R-2: GTGACTGGAGTTCAGACGTGTGCTCTTCCGA TCTATACTGCCATTTGTCTCGAGGTC IDT N/A Illumina TruSeq UDI index set Illumina N/A oAN491 (custom TSO oligo with UMI used with Takara smRNA kit) IDT N/A oAN426 (custom cDNA amplification primer R, used with Takara smRNA kit) IDT N/A oAN425 (example of custom cDNA amplification primer F, used with Takara smRNA kit IDT N/A Recombinant DNA pUC6 Addgene Cat #49793 pLKO.1 Addgene Cat #10878 pLKO.1 shctrl This paper N/A pLKO.1 oncRNA.ch7.29 This paper N/A pLKO.1 oncRNA.ch17.67 This paper N/A (Continued on next page) e2 Cell Reports Medicine 7, 102577, February 17, 2026 Article ll OPEN ACCESS ..

    Recombinant:

    Article Title: Systematic annotation of orphan RNAs reveals blood-accessible molecular barcodes of cancer identity and cancer-emergent oncogenic drivers.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit Anti-Vimentin antibody [EPR3776] - Cytoskeleton Marker Abcam Cat#ab92547; RRID: AB_10562134 Rabbit Anti-E Cadherin antibody [EP700Y] - Intercellular Junction Marker Abcam Cat#ab40772; RRID: AB_731493 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 ThermoFisher Scientific Cat#A-11034; RRID: AB_2576217 Human IgG (Fc) Polyclonal - Isotype Control Abcam Cat#ab206214 Bacterial and virus strains MegaX DH10B T1R electrocompetent cells Invitrogen Cat. #C640003 Biological samples Serum samples from human patients ISPY-2 Clinical Trial N/A Chemicals, peptides, and recombinant proteins FD Esp3I Thermo Fisher Cat. #FD0454 AgeI-HF NEB Cat. #R3552S EcoRI-HF NEB Cat. #R3101S Penicillin-Streptomycin-Glutamine (100×) Thermo Fisher Cat#10378016 Amphotericin B Thermo Fisher Cat#30-003-CF Corning Matrigel Basement Membrane Matrix, LDEV-free Corning Cat#354234 D-luciferin Revvity Cat#122799 Critical commercial assays DNA Clean and Concentrator kit-5 Zymo Research Cat. #D4003 MinElute PCR purification kit Qiagen Cat. #28004 Select-a-Size DNA Clean & Concentrator MagBead Kit Zymo Cat. #D4084 MiSeq v2 Illumina Cat. #MS-102-2002 Quick-DNA midiprep plus kit Zymo Research Cat. #D4075 QuantSeq 3′ mRNA-Seq Library Prep Kit FWD Lexogen Cat. #015 SMARTer® smRNA-Seq Kit for Illumina Takara Bio Cat#635031 Quick-cfRNA Serum & Plasma Kit Zymo Research Cat#R1059 Deposited data mRNA-seq In this paper Accession: E-MTAB-16091 Experimental models: Cell lines MDA-MB-231 ATCC Cat#HTB-26 SW480 ATCC Cat#CCL-228 A549 ATCC Cat#CCL-185 C4-2B ATCC Cat#CRL-3315 MDA-MB-231 shctrl This paper N/A HCC1806 shctrl This paper N/A MDA-MB-231 oncRNA.ch7.29 This paper N/A HC1806 oncRNA.ch7.29 This paper N/A MDA-MB-231 oncRNA.ch17.67 This paper N/A HCC1806 oncRNA.ch17.67 This paper N/A MCF7 ATCC Cat#HTB-22 (Continued on next page) Cell Reports Medicine 7, 102577, February 17, 2026 e1 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER A375 ATCC Cat#CRL-1619 LS174T ATCC Cat#CL-188 PANC-1 ATCC Cat#CRL-1469 MDA-MB-453 ATCC Cat#HTB-131 Hs 707(A).T ATCC Cat#CRL-7448 HEK293 ATCC Cat#CRL-1573 A2058 ATCC Cat#CRL-3601 HCC-44 DSMZ Cat#ACC534 NCI-H23 ATCC Cat#CRL-5800 NCI-H1299 ATCC Cat#CRL-5803 NCI-H358 ATCC Cat#CRL-5807 BxPC-3 ATCC Cat#CRL-1687 LNCaP ATCC Cat#CRL-1740 ZR-75-1 ATCC Cat#CRL-1500 K-562 ATCC Cat#CCL-243 MIA PaCa-2 ATCC CatCRL-1420 COLO320DM ATCC Cat#CCL-220 HCT116 ATCC Cat#CCL-247 SW620 ATCC Cat#CCL-227 PC-3 ATCC Cat#CRL-1435 Experimental models: Organisms/strains NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ Jackson Laboratory Strain#005557 Oligonucleotides oncTuD library amplification F:ATTTTGCCCCTGGTTCTT IDT N/A oncTuD library amplification R:CCCTAAGAAATGAACTGG IDT N/A oncTuD amplicon-F: GGAAAGGACGAAACACCGGT IDT N/A oncTuD amplicon-R: ATACTGCCATTTGTCTCGAGGTC IDT N/A oncTuD amplicon-F-2: ACACTCTTTCCCTACACGACGCTCTTCCG ATCTGGAAAGGACGAAACACCGGT IDT N/A oncTuD amplicon-R-2: GTGACTGGAGTTCAGACGTGTGCTCTTCCGA TCTATACTGCCATTTGTCTCGAGGTC IDT N/A Illumina TruSeq UDI index set Illumina N/A oAN491 (custom TSO oligo with UMI used with Takara smRNA kit) IDT N/A oAN426 (custom cDNA amplification primer R, used with Takara smRNA kit) IDT N/A oAN425 (example of custom cDNA amplification primer F, used with Takara smRNA kit IDT N/A Recombinant DNA pUC6 Addgene Cat #49793 pLKO.1 Addgene Cat #10878 pLKO.1 shctrl This paper N/A pLKO.1 oncRNA.ch7.29 This paper N/A pLKO.1 oncRNA.ch17.67 This paper N/A (Continued on next page) e2 Cell Reports Medicine 7, 102577, February 17, 2026 Article ll OPEN ACCESS ..



    Similar Products

    95
    ATCC 1420 colo320dm atcc cat
    1420 Colo320dm Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/1420+colo320dm+atcc+cat/COLO+320DM/pm41579861-281-54-56
    Average 95 stars, based on 1 article reviews
    1420 colo320dm atcc cat - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    Image Search Results